• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    these are a new promoter, a vector comprising the promoter, a microorganism comprising the promoter or vector, and a method for producing a target product using the microorganism.
    公开号:BR112019004161B1
    申请号:R112019004161-3
    申请日:2017-03-20
    公开日:2021-07-27
    发明作者:Young Mi Lee；Seung Bin Lee；Seong Bo Kim；Ji Hyun Lee；Seung Hyun Cho；Seung Won Park；Jin Sook Chang
    申请人:Cj Cheiljedang Corporation；
    IPC主号:
    专利说明:

    Technical Field
    [001] This invention relates to a new promoter, a vector comprising the promoter, a microorganism comprising the promoter or vector and a way to produce a target product with the use of the microorganism. Fundamentals of Technique
    [002] Continuous efforts have been made to produce target products, such as amino acids or useful materials that can be used for various purposes, which include feed, medicine, food, etc., in high titer with the use of micro- organisms (Korean Patent No. 10-0924065). As one of these methods, a method exists to induce the overexpression of a target gene in a microorganism, and a high-efficiency gene expression system is needed for this purpose. Since promoters are one of the factors that are significantly involved in gene expression systems, the development of a useful promoter is essential.
    [003] The E. coil-derived tac promoter is widely known as a strong promoter. In the case of the microorganism in the form of Coryne, strong promoters were developed by modifying autogene promoters (Gene, 102, 93-98, 1991; Microbiology, 142, 1297-1309, 1996). For example, in the case of promoters derived from Corynebacterium ammoniagenesis, it is reported that there is about 10% improvement compared to that of the tac promoter reported in E. coli (Biotechnol. Lett. 25, 1311-1316, 2003). Furthermore, as strong promoters derived from Corynebacterium ammoniagenesis, Pcj1 to Pcj7 promoters with various strengths have been developed and they have strong promoter activities, at least 10 times higher than that of the tac promoter (Korean Patent No. 10-0620092). Furthermore, the Po2 promoter was developed, which was synthesized from Corynebacterium glutamicum to have strong promoter activity (Korean Patent No. 10-1632642). However, there is still a need for the development of a promoter, since a system that exhibits high expression efficiency in Corynebacterium compared to the E. coli gene expression system is needed.
    [004] Under these circumstances, the present inventors have made many efforts to discover promoters that can strongly induce gene expression in a microorganism of the Corynebacterium genus. As a result, they developed a new synthesized promoter of the present disclosure and confirmed that the promoter has a higher expression activity compared to known promoters, thus completing the present disclosure. Technical Problem Disclosure
    [005] An objective of the present disclosure is to provide a new nucleic acid molecule that has promoter activity; a gene expression cassette that contains the nucleic acid molecule and a target gene; a recombinant vector that contains the nucleic acid molecule or gene expression cassette; a recombinant microorganism that contains the promoter or vector; and a method for producing a target product using the recombinant microorganism. Technical Solution
    [006] To achieve the objectives of the present disclosure, an aspect of the present invention provides a nucleic acid molecule having a promoter activity consisting of any nucleotide sequence selected from the group consisting of SEQ Nos: 1 to 3 .
    As used in the present disclosure, the term "promoter" refers to an untranslated nucleic acid sequence located upstream of a coding region, which includes a polymerase binding site and has the activity of initiating transcription of a gene located downstream of a promoter in mRNA, that is, a domain of DNA to which the polymerase binds and initiates the transcription of a gene. The promoter can be located in the 5' domain of the mRNA transcription initiation domain.
    [008] In the present disclosure, nucleic acid molecules, which have the promoter activity consisting of any nucleotide sequence selected from the group consisting of SEQ Nos: 1 to 3 (i.e., a nucleotide sequence of SEQ N °: 1, SEQ NO: 2 or SEQ NO: 3), were designated as SPL1, SPL7, and SPL13, respectively. Nucleic acid molecules which possess the promoter activity may also be termed as promoters, and all terms described above may be used in the present disclosure.
    [009] The promoter of the present disclosure allows the expression of a target gene, which is operably linked to the nucleic acid molecule that has the promoter activity in a target microorganism, and can be used as a promoter of use general.
    [010] In addition, the promoter sequence of the present disclosure can be modified by conventionally known mutagenesis, for example, direct evolution, site-directed mutagenesis, etc. Accordingly, the promoter may include, without limitation, any nucleotide sequence having a homology of 70% or greater, specifically, 80% or greater, more specifically, 90% or greater, even more specifically, 95% or greater, even more specifically , 98% or higher, and more specifically 99% or higher, for the nucleotide sequence of SEQ NO: 1, SEQ NO: 2 or SEQ NO: 3, and which has a similar promoter activity. Furthermore, any nucleotide sequence with the above homology, in which part of the sequence is deleted, modified, substituted or inserted, shall be construed as falling within the scope of the nucleic acid molecule of the present disclosure, provided that the sequence has an activity prosecutor.
    [011] In particular, the expression "consisting of the nucleotide sequence of SEQ N°: 1, SEQ N°: 2 or SEQ N°: 3" does not exclude the cases of addition and/or deletion and/or modification, etc., of a nucleotide that can occur while binding to a target gene together with the use of a restriction enzyme, when the corresponding promoter is used for binding to the target gene.
    [012] Specifically, in addition to the promoter to carry out gene transcription, any operator sequence to control transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence to control transcription and translation can be included. For example, the control sequence suitable for prokaryotes can include any operator sequence or ribosome binding domain, but is not limited thereto. The nucleic acid molecule which possesses the promoter activity of the present disclosure may be comprised of a sequence to control gene expression as described above, as needed by one of ordinary skill in the art.
    [013] The nucleic acid molecule, which consists of any nucleotide sequence selected from the group consisting of SEQ ID Nos: 1 to 3 nucleotide sequences that have a promoter activity, may include, without limitation, a probe which can be prepared from a known genetic sequence, for example any nucleotide sequence which has the promoter activity of the present disclosure, by hybridizing to a sequence complementary to the entire or partial nucleotide sequence of SEQ ID NOs: 1 to 3 of the present disclosure under a strict condition.
    [014] As used herein, the term "homology" refers to a percentage identity between two polynucleotide or polypeptide moieties. Sequence homology from one portion to another can be determined by a technique known in the art. For example, homology can be confirmed by using standard software to calculate parameters such as score, identity and similarity (specifically, BLAST 2.0) or by comparing sequences through Southern hybridization experiments under conditions defined strings, and the defined proper hybridization condition can be determined by a method well known to one skilled in the art within the scope of the corresponding technology (eg J. Sambrook et al., "Molecular Cloning, A Laboratory Manual", 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York).
    [015] The "stringent condition" refers to a condition that allows specific hybridization between polynucleotides. This condition is described in detail in references (for example, J. Sambrook et al., Supra). For example, a hybridization condition, where genes with high homology (eg genes with a homology of 80% or more, specifically 90% or more, more specifically 95% or more, even more specifically 97% or more, and even more specifically 99% or higher) are hybridized, and genes with a lower homology than the above are not hybridized; or a wash condition, in which the wash is performed once, specifically 2 to 3 times, under conditions of salt concentrations and temperature that correspond to a conventional wash condition for Southern hybridization (i.e., 60°C, 1 * SSC and 0.1% SDS), specifically, 60 °C, 0.1 * SSC, 0.1% SDS, more specifically 68 °C, 0.1 x SSC and 0.1% SDS, can be included. Although a mismatch between nucleotides can occur due to the stringency of hybridization, it is necessary that the two nucleic acids have a complementary sequence. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize to each other. For example, with respect to the nucleotide bases, adenosine is complementary to thymine and cytosine is complementary to guanine. Thus, the present disclosure can include not only substantially similar nucleic acid sequences, but also isolated nucleic acid fragments that are complementary to the entire sequence. Specifically, the polynucleotide that has a homology can be detected using a hybridization condition, which includes the hybridization condition at a Tm value of 55 °C and the conditions described above. Furthermore, the Tm value can be 60°C, 63°C, or 65°C, but it is not limited to that and can be properly controlled by a person skilled in the art according to the objectives. It is well known that the stringency of hybridization of polynucleotides depends on the length and degree of complementarity of the polynucleotides, and the variables are well known in the art (see Sambrook et al., Supra, 9.50 to 9.51, 11.7 to 11 .8).
    [016] The nucleic acid molecule having a promoting activity of the present disclosure can be isolated or prepared using standard molecular biology techniques. For example, the nucleic acid molecule can be prepared using standard synthesis technology that utilizes an automated DNA synthesizer, but the preparation is limited to that.
    [017] Another aspect of the present disclosure provides a gene expression cassette that includes the nucleic acid molecule and target gene of the present disclosure.
    [018] The nucleic acid molecule of the present disclosure is the same as that explained above.
    [019] As used herein, the term "gene expression cassette" refers to a unit cassette that includes a promoter and a target gene and thus can express a target gene operably linked downstream of the promoter . Such a gene expression cassette can include several factors that can help the efficient expression of the target gene, either inside or outside the cassette. The gene expression cassette may conventionally include a transcription termination signal, a ribosome binding domain and a translation termination signal, in addition to the promoter operably linked to the target gene.
    [020] As used herein, the term "target gene" refers to a gene that encodes a protein to be expressed in a microorganism.
    [021] For example, the target gene may be a gene involved in the production of a product selected from the group consisting of saccharides (eg psychosis or tagatose), L-amino acids (L-lysine, L-valine, etc.). ), organic acids, enzymes and a combination of these, but not limited to these. Specifically, the target gene can be a gene that encodes a sugar-converting enzyme or an enzyme associated with amino acid biosynthesis, a gene that encodes an enzyme associated with reducing power, a gene that encodes an enzyme associated with acid biosynthesis or a gene that encodes an enzyme associated with the release of a target product, but is not limited to these. More specifically, the target gene may be a gene encoding psychosis epimerase, a gene encoding tagatose epimerase, or a gene encoding tagaturonate epimerase, a gene encoding NADP-dependent glyceraldehyde-3-phosphate dehydrogenase, or a gene that encodes but is not limited to a branched-chain amino acid aminotransferase.
    [022] Psychosis epimerase may be referred to as ATPE and refers to psychosis-3-epimerase which has an activity of converting fructose to psychosis. In addition, tagaturonate epimerase or tagatose epimerase (hexuronic acid C4-epimerase; Korean Patent No. 10-1,550,796) may be referred to as UxaE, and refers to an enzyme that has an activity of converting fructuronate to tagaturonate or convert fructose to tagatose. NADP-dependent glyceraldehyde-3-phosphate dehydrogenase can be referred to as GapN, and refers to an enzyme that has a converting activity to 3-phosphoglycerate with the use of glyceraldehyde-3-phosphate as a substrate. The branched-chain amino acid aminotransferase can be denoted as IlvE and refers to the last step enzyme in the branched-chain amino acid biosynthetic pathway. The sequences of the genes encoding ATPE, UxaE, GapN and IlvE can be easily obtained from a known database, such as the GenBank of the NIH (USA), by a person skilled in the art. The genes encoding ATPE, UxaE, GapN, and IIvE are illustrative target genes that can be operably linked to a nucleic acid molecule that possesses the activity of the promoter of the present disclosure, and the promoter of the present disclosure can use , without limitation, any gene, which can be expressed in a microorganism by a general purpose promoter, such as a target gene. As used herein, the term "operably linked" means that the sequence of the above genes and a promoter sequence are operably linked so that the nucleic acid sequence having the promoter activity of the present disclosure can initiate and mediate transcription of the target gene. Operable ligation can be prepared using a recombinant genetic technology well known in the art, and site-specific DNA cleavage and ligation can be prepared using cleavage and ligation enzymes, etc., in the art, but it is not limited to that.
    [023] Another aspect of the present disclosure provides a recombinant vector, which includes the nucleic acid molecule of the present disclosure or the gene expression cassette of the present disclosure.
    [024] The nucleic acid molecule and the gene expression cassette are the same explained above.
    [025] As used herein, the term "vector" is an artificial DNA molecule that has a genetic material to allow the expression of a target gene in a suitable host cell and, specifically, a DNA construct that includes the nucleotide sequence of a gene operably linked to a suitable regulatory sequence. The regulatory sequence may include, in addition to the promoter capable of initiating transcription, any operator sequence for the regulation of such transcription, a sequence encoding a suitable mRNA ribosome binding domain and a sequence for the regulation of transcription and translation, but is not limited to that.
    [026] The vector used in the present disclosure may not be particularly limited, as long as the vector is expressed in a host cell, and the host cell can be transformed using any vector known in the art. Examples of the vector conventionally used can include natural or recombinant plasmids, cosmids, viruses and bacteriophages. For example, as a phage vector or cosmid vector, pWE15, M13, BL3, BL4, AIXII, ASHII, ÀAPII, Àt10, Àt11, Charon4A, Charon21A, etc. can be used; and as plasmid vector, those based on pBR, pUC, pBluescriptII, pGEM, pTZ, pCL, pET, etc. can be used. The vector to be used in the present disclosure is not particularly limited, but any known expression vector can be used. Furthermore, the endogenous promoter within the chromosome can be replaced by a nucleic acid molecule having the promoter activity of the present disclosure by a vector to insert chromosome into a host cell. Insertion of the nucleic acid molecule into the chromosome can be performed by a method well known in the art, for example, homologous recombination. For example, pECCG117, pDZ, pACYC177, pACYC184, PCL, pUC19, pBR322, pMW118, pCC1BAC, pCES208, pXMJ19 vectors, etc. can be used, but the vector is not limited to this. Since the vector of the present disclosure can be inserted into the chromosome via homologous recombination, a selection marker to confirm insertion into the chromosome can further be included. The selection marker is used for selection of a transformed cell, that is, to confirm insertion of the target nucleic acid molecule, and markers capable of providing selectable phenotypes, such as drug resistance, nutrient requirement, resistance to cytotoxic agents, and the expression of surface proteins, can be used. Under the circumstances where selective agents are treated, only cells capable of expressing the selection markers can survive or express other phenotypic characteristics, and thus transformed cells can be selected.
    [027] As used herein, the term "transformation" refers to a process for introducing a vector that includes a polynucleotide encoding a target protein into a host cell, thereby allowing expression of the polynucleotide encoded by the protein into the host cell. For the transformed polynucleotide, it does not matter whether it is inserted into the chromosome of a host cell and located there or located outside the chromosome, as long as it can be expressed in the host cell. In addition, the polynucleotide includes DNA and RNA that encode the target protein. The polynucleotide can be inserted in any form as long as it can be introduced into a host cell and expressed there. For example, the polynucleotide can be introduced into a host cell in the form of an expression cassette, which is a gene construct that includes all the essential elements necessary for self-expression, or in the form of a vector that includes the cassette. of expression. The expression cassette or vector which includes the polynucleotide may be those which include, for example, a nucleic acid molecule which consists of the nucleotide sequence consisting of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID No. 3 of the present disclosure, which has a promoter activity, and may be a vector, to which a target gene is not operably linked. Even in this case, the nucleic acid molecule that has the promoter activity can be replaced by the endogenous promoter in the host cell (eg, a microorganism of the Corynebacterium genus) and by homologous recombination. As such, the endogenous gene within the host cell can be expressed.
    [028] The transformation method can include any method that can introduce the nucleic acids into a cell, and the transformation can be performed by selecting an appropriate standard technique, as is known in the art depending on the host cell. For example, the method may include electroporation, calcium phosphate precipitation (CaPO4), calcium chloride precipitation (CaCl2), microinjection, a polyethylene glycol (PEG) method, a DEAE-dextran method, a liposome method cationic, and a lithium acetate DMSO method, etc., but not limited to that.
    [029] Yet another aspect of the present disclosure provides a recombinant microorganism that includes a nucleic acid molecule that has the promoter activity of the present disclosure, the gene expression cassette or a recombinant vector that includes the gene expression cassette.
    [030] The nucleic acid molecule that has the promoter activity, the gene expression cassette and the recombinant vector are the same explained above.
    [031] The gene expression cassette and the recombinant vector can be introduced into a microorganism by transformation.
    [032] In addition, the transformation is the same as explained above.
    [033] As used herein, the term "microorganism" is a concept that includes both a wild-type microorganism and a naturally or artificially genetically modified microorganism, and may be a microorganism that possesses a weakened or improved mechanism, in particular, due to insertion of a foreign gene or improvement or impairment of the activity of an endogenous gene. As used herein, the microorganism can include, without limitation, any microorganism into which the nucleic acid molecule, which has the promoting activity of the present disclosure, is introduced and is capable of functioning as a promoter.
    [034] Specifically, the microorganism can be a microorganism of the genus Corynebacterium, and more specifically, Corynebacterium glutamicum, Corynebacterium ammoniagenes, Brevibacterium lactofermentum, Brevibacterium flavum, Corynebacterium thermoaminogenes, Corynebacterium efficiens, etc. Even more specifically, the microorganism may be Corynebacterium glutamicum, but it is not limited to that.
    [035] In yet another aspect, the present disclosure provides a method for producing a target product, which includes (a) culturing the recombinant microorganism of the present disclosure in a medium; and (b) recovering a target product from the microorganism or from the medium in which the microorganism was cultured.
    [036] As used herein, the term "target product" may be selected from the group consisting of saccharides (eg psychosis or tagatose), L-amino acids (eg L-lysine, L-valine), organic acids , enzymes, and a combination thereof. The "saccharide" refers to a carbohydrate with a sweet taste, and may be selected from the group consisting of, for example, glucose, fructose, galactose, allulose, tagatose, xylose, lactose, sucrose and a combination of these, but not is limited to that.
    [037] The "amino acid" or "L-amino acid" refers, in general, to a basic constitutive unit of a protein, in which an amino group and a carboxyl group are attached to the same carbon atom. The amino acid can be selected from the group consisting, for example, of glycine, alanine, valine, leucine, isoleucine, threonine, serine, cysteine, glutamine, methionine, aspartic acid, asparagine, glutamic acid, lysine, arginine, histidine, phenylalanine, tyrosine, tryptophan, proline, and a combination thereof, but not limited to that. Organic acids can be organic compounds that have an acidic property, for example those compounds in which a carboxy group and a sulfonic group are included. Specific examples of organic acids may include lactic acid, acetic acid, succinic acid, butyric acid, palmitic acid, oxalic acid, tartaric acid, citric acid, propionic acid, hexanoic acid, capric acid, caprylic acid, valeric acid, or citric acid , but are not limited to that. "Enzymes" refer to protein catalysts that mediate chemical reactions that occur in living organisms, and specifically, enzymes play the role of catalysts that reduce the activation energy needed for a reaction by forming an enzyme-substrate complex upon binding to substrates. For example, some enzymes may be involved in saccharide production (eg, psychosis or tagatose), and more specifically, these enzymes may be psychosis epimerase, tagatose epimerase, or tagaturonate epimerase, but are not limited to these. Target products can include any target product, which can be produced by expression of a target gene, which is operably linked to the promoter of the present disclosure, but target products are not limited thereto.
    [038] As used herein, the term "culture" refers to the growth of a microorganism under adequately and artificially controlled environmental conditions. In the present disclosure, the culture process can be carried out based on suitable culture conditions and culture medium widely known in the art. Specifically, the culture process can be carried out continuously in a batch, a fed batch or a repeated fed batch process, but is not limited to this.
    [039] The medium used in the culture must adequately meet the requirements of specific strains. Culture media for microorganisms of the Corynebacterium genus and the Escherichia genus are disclosed (eg, Manual of Methods for General Bacteriology. “American Society for Bacteriology.” Washington, D.C., USA, 1981). As a carbon source to be used in the medium, sugars and carbohydrates, such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil and coconut oil; fatty acids such as palmitic acid, stearic acid and linoleic acid; alcohols such as glycerol and ethanol; and organic acids, such as gluconic acid, acetic acid, and pyruvic acid, may be included, but are not limited to these. These materials can be used individually or as a blend. As a nitrogen source to be used, peptone, yeast extract, meat extract, malt extract, corn liquor, powdered soybean meal and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate can be included, but the nitrogen source is not limited to that. The nitrogen source can also be used individually or as a mixture. As a phosphorus source, potassium dihydrogen phosphate or dipotassium hydrogen phosphate can be used or the corresponding sodium containing salts can be used, but the phosphorus source is not limited to this. In addition, the culture medium can include a metal salt, such as magnesium sulfate or iron sulfate, which is essential for growth. Furthermore, essential materials for growth, such as amino acids and vitamins, can be used in addition to the materials mentioned above. Furthermore, appropriate precursors can be added to the culture medium. Specifically, when an enzyme is produced as a target product, the enzyme's substrate may be contained in the medium. For example, fructose, which can serve as a substrate for psychosis epimerase, tagatose epimerase or tagaturonate epimerase, can be included in the medium. The above source materials can be properly fed into the culture in a batch or continuous manner during the culture process. These various processes of culture are revealed, for example, in the reference ("Biochemical Engineering", by James M. Lee, Prentice-Hall International Editions, pp. 138-176).
    [040] The pH of the culture can be adjusted by an appropriate basic compound such as sodium hydroxide, potassium hydroxide or ammonia, or an acidic compound such as phosphoric acid or sulfuric acid. In addition, foaming can be adjusted by an anti-foaming agent such as a polyglycol fatty acid ester. To maintain the aerobic condition of the crop, oxygen or gas mixtures containing oxygen (eg air) may be introduced. The culture temperature can generally be in the range of 20 °C to 45 °C, specifically 25 °C to 40 °C, but the temperature is not limited to these and can be changed according to the conditions of culture.
    [041] The method for producing a target product of the present disclosure may include a step to recover the target product from the micro-organism of the present disclosure or the medium in which the micro-organism was cultured. The method of producing a target product from the microorganism or media in which the microorganism was cultured is to isolate or recover the target product using an appropriate reaction disclosed in the art. For example, methods may include treatment by a protein precipitant (a salting-out method), centrifugation, extraction, ultrasound, ultrafiltration, dialysis, various chromatographic methods such as molecular sieve chromatography (gel filtration) , adsorption chromatography, ion exchange chromatography, affinity chromatography, etc., and a combination of these, but not limited to these. The recovery step may include a purification process, and one skilled in the art may select the process from various purification processes and use it as needed. Advantageous Effects of the Invention
    [042] The new promoter of the present disclosure may have various activities according to the microorganisms that induce the expression of a target gene. Therefore, when it is necessary to control the activity of the target gene when necessary during production of the target product, the target product can be efficiently produced using the novel promoter of the present disclosure. Brief Description of Drawings
    [043] Figure 1 shows the results of the GFP assay that illustrate the measured strength of new promoters; Figure 1(A) shows the results of the Corynebacterium glutamicum ATCC13032 based novel promoter GFP assay, and the Figure 1(B) shows the results of the Corynebacterium glutamicum ATCC13869 based novel promoter GFP assay; Figure 2 shows the HPLC results confirming the production of psychosis; Figure 2(A) shows the result of reaction with fructose as substrate using Corynebacterium glutamicum ATCC13032/CJ4-ATPE-2, figure 2(B) shows the result of reaction with fructose as substrate using Corynebacterium glutamicum ATCC13032/SPL1-ATPE-2, and Figure 2(C) shows the result of the reaction with fructose as substrate using Corynebacterium glutamicum ATCC13032/SPL7-ATPE-2; Figure 3 shows HPLC results confirming tagatose production; Figure 3(A) shows the result of the reaction with fructose as substrate using Corynebacterium glutamicum ATCC13032/CJ4-TN(m), and figure 3(B) shows the result of the reaction with fructose as substrate using ATCC13032/SPL13-TN (m). Detailed Description of the Invention
    [044] Hereinafter, the present disclosure will be described in more detail with reference to the Examples below, etc., to aid understanding of the present disclosure. However, these Examples may be modified in various other ways and the scope of the present disclosure is not to be construed to be limited by these Examples. The Examples of the present disclosure are provided for the purpose of a complete explanation for those of ordinary skill in the art. Example 1: Confirmation of target gene expression induced by a new 1-1 promoter. Preparation of Recombinant Vectors Containing New Promoter Sequences
    [045] For the synthesis of a new promoter capable of inducing the expression of a target gene, several promoter sequences derived from a microorganism of the genus Corynebacterium and a microorganism of the genus Escherichia were analyzed. Promoters having the nucleotide sequence represented by SEQ ID Nos: 1, 2 and 3 were synthesized and named as SPL1, SPL7, and SPL13, respectively.
    [046] Based on the SPL1, SPL7, and SPL13 promoters prepared by the synthesis as templates, the PCR was performed using the primers of SEQ N°: 4 and SEQ N°: 5, which include the KpnI/EcoRV restriction sites [Sambrook et al.,"Molecular Cloning, a Laboratory Manual" (1989), Cold Spring Harbor Laboratories]. PCR was performed under the following conditions: denaturation at 94°C for 5 minutes; 30 cycles of denaturation at 94°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 30 seconds; and extension at 72°C for 7 minutes. As a result, SPL1, SPL7, and SPL13 at a size of about 300 bp were obtained.
    [047] The open reading frame (ORF) of the GFP gene was obtained by performing PCR using the vector pGFPuv (C lontech, USA) as a template together with the primers of SEQ N°: 6 and SEQ N°: 7 which include PstI/EcoRV restriction sites. PCR was performed under the following conditions: denaturation at 94°C for 5 minutes; 30 cycles of denaturation at 94 °C for 30 seconds, annealing at 55 °C for 30 seconds, and extension at 72 °C for 1 minute; and extension at 72°C for 7 minutes. As a result, the GFP gene fragment (SEQ NO: 14) of about 716 bp was obtained.
    [048] In the PstI and KpnI restriction sites of a pECCG117 transport vector ("Biotechnology letters", vol. 13, No. 10, pp. 721 to 726 (1991), (Korean Patent No. 101992-0007401)) which can be expressed in microorganism in the form of E. coli and Coryne, each of SPL1, SPL7, and SPL13, which has been treated with the restriction enzymes KpnI and EcoRV, and the GFP ORF of the gene which has been treated with PstI and EcoRV were operably linked to each other using a DNA ligase and thus recombinant vectors, in which each of SPL1, SPL7, and SPL13 is linked to GFP, were prepared and they were named as pSPL1 -GFP, pSPL7-GFP, and pSPL13-GFP, respectively. 1-2. Preparation of processed strains
    [049] The pECCG117 vector, the recombinant vectors (pSPL1-GFP, pSPL7-GFP and pSPL13-GFP) were prepared above, and p117-CJ4-GFP, which include a previously disclosed pcj4 promoter (Korean Patent No. 10-0620092) , were transformed into Corynebacterium glutamicum ATCC13032 and Corynebacterium glutamicum ATCC13869 by the electric pulse method ("Appl. Microbiol. Biotechnol" (1999) 52: 541-545), respectively, and the transformed strains were obtained on a Luria-Bertani agar plate ( LB) which contains kanamycin (25 mg/L). The strains obtained on the basis of ATCC13032 were named Corynebacterium glutamicum ATCC13032/pECCG117, Corynebacterium glutamicum ATCC13032/SPL1-GFP, Corynebacterium glutamicum ATCC13032/SPL7-GFP, Corynebacterium glutamicum ATCC13032/SPL13-GFP and Corynebacterium glutamicum ATCC4130/GFP, respectively, ATCC43032/GFP. In addition, the strains obtained on the basis of ATCC13869 were named as Corynebacterium glutamicum ATCC13869/pECCG117, Corynebacterium glutamicum ATCC13869/SPL1-GFP, Corynebacterium glutamicum ATCC13869/SPL7-GFP, Corynebacterium glutamicum ATCC13869/SPL13-GFP86-GFP4 and Corynebacterium glutamicum ATCC13869/SPL13-GFP86-GFP4 , respectively.
    [050] The 6 types of strains obtained by the above transformation, i.e. ATCC13032/SPL7-GFP, ATCC13032/SPL13-GFP, ATCC13032/SPL1-GFP, ATCC13869/SPL7-GFP, ATCC13869/SPL13-GFP and ATCC13869/SPL1- GFP, were designated as CA01-2301, CA01-2302, CA01-2303, CA01-2304, CA01-2305 and CA01-2306, respectively, and then deposited with the Korean Microorganism Culture Center (KCCM), an international depositary authority under the Budapest Treaty, on 2.17.2017, with accession numbers KCCM11971P, KCCM11972P, KCCM11973P, KCCM11974P, KCCM11975P and KCCM11976P. 1-3. Confirmation of activities of new promoters
    [051] For confirmation of the activities of the SPL1, SPL7 and SPL13 promoters, the transformed strains obtained in Example 1-2 (i.e., Corynebacterium glutamicum ATCC13032/pECCG117, Corynebacterium glutamicum ATCC13032/CJ4-GFP, Corynebacterium glutamicum ATCC13032/SPL1-GFP , Corynebacterium glutamicum ATCC13032/SPL7-GFP, Corynebacterium glutamicum ATCC13032/SPL13-GFP, Corynebacterium glutamicum ATCC13869/pECCG117, Corynebacterium glutamicum ATCC13869/CJ4-GFP, Corynebacterium glutamicum ATCC13869/SPL13-GFP, Corynebacterium glutamicum ATCC13869/pECCG117, Corynebacterium glutamicum ATCC13869/CJ4-GFP, Corynebacterium glutamicum ATCC13869/SPL7-GFP and Corynebacterium glutamicum ATCC13869/SPL1-GFP ATCC13869/SPL13-GFP) were grown by the method described below and their GFP activities were measured.
    [052] The transformed strains were inoculated into each flask containing 25 ml of a culture medium (glucose (20 g), ammonium sulfate ((NH4)2SO4) (5 g), yeast extract (5 g), urea (1.5 g), KH2PO4 (4 g), K2HPO4 (8 g), MgSO4-7H2O (0.5 g), biotin (150 μg), thiamine HCl salt (1.5 mg), calcium acid -pantothenic (3 mg) and nicotinamide (3 mg) (based on 1L distilled water), pH 7.2) and grown in a shaking incubator at 30°C for 20 hours. Bacterial cells were recovered by centrifugation (5000 rpm, 15 min), washed twice with 50 mM Tris-HCl buffer (pH 8.0) and suspended in the same buffer. Glass beads were added to the suspension (1.25 g/1.5 mL), and the bacterial cells were stopped using a ball beater for 6 minutes. Then, the resultant was subjected to centrifugation (15000 rpm, 20 minutes), the supernatant was recovered from them, and the protein concentration was quantified by the Bradford method. For an equal amount of bacterial cell extracts, excited light was irradiated at 488 nm, according to a method introduced by Laure Gory et al. (FEMS Microbiology Letters, 194, 127-133, 2001), and the light emitted at 511 nm was measured using the LS-50B spectrophotometer (Perkin-Elmer) and thus the level of GFP gene expression was measured ( Table 1). Table 1

    [053] As shown in Table 1 above, all of SPL1, SPL7 and ASPL13 showed their promoter activities in two different types of Corynebacterium glutamicum and also showed greater sensitivity to fluorescence than the pcj4 promoter, which is known to be a strong promoter. From these results, it was found that SPL1, SPL7 and SPL13 are very strong promoters that can express target genes in Corynebacterium glutamicum. Example 2. Assessing the ability to produce target products 2-1. Assessment of the ability to produce psychosis (1) Preparation of vectors and transformed strains for expression of ATPE that include SPL1 and SPL7 promoter sequences
    [054] Corynebacterium strain vectors with increased expression of ATPE (psychosis epimerase derived from Agrobacterium tumefaciens) were prepared using SPL1 and SPL7. The open reading frame (ORF) of the ATPE gene was amplified by performing PCR (30 reaction cycles of 30 seconds at 94 °C, 30 seconds at 55 °C and 1 minute at 72 °C) using the pET24- vector ATPE-2 (SEQ ID NO: 8) as template, together with the primers of SEQ ID Nos: 9 and 10. The amplified ATPE gene and the vectors pSPL1-GFP and pSPL7-GFP for Corynebacterium strains prepared from Example 1 were treated with the restriction enzymes EcoRV and PstI, and the ATPE-2 obtained by PCR was operably linked to them using the BD In fusion kit and thus the vectors pSPL1-ATPE-2 and pSPL7-ATPE- 2 for Corynebacterium strains were finally prepared.
    [055] The vectors pSPL1-ATPE-2 and pSPL7-ATPE-2 thus prepared were introduced into the strain ATCC13032 by electroporation, and thus the strains SPL1-ATPE-2 and SPL7-ATPE-2 were prepared. (2) Assessment of the ability to produce psychosis by transformed strains
    [056] The strains prepared by the above procedure were cultivated using the medium with the same composition as in Example 1 and their ATPE activities were measured. The ATCC13032/pECCG117 and ATCC13032/CJ4-ATPE-2 strains were used as control groups.
    [057] The strains were grown overnight in solid LB medium placed in an incubator at 30 °C and the overnight culture of each strain was inoculated into a 25 ml medium and grown in a shaking incubator at 30 °C for 24 hours. The culture was centrifuged and the supernatant removed. The recovered bacterial bodies were washed with EPPS solution (pH 8.0) and the sediment thus obtained was dissolved in EPPS solution (pH 8.0). POESA (1 mg/ml) was added, reacted at room temperature for 1 hour and centrifuged. Then, the resulting pellet obtained by centrifugation was dissolved in EPPS solution (pH 8.0), and a fructose solution (350 g/L) as substrate was added thereto and reacted at 50 °C for 3 hours, and the reaction was stopped by heat treatment. Then, a supernatant was recovered by centrifugation and the amount of psychosis production was measured by HPLC analysis (figure 1 (A), 1 (B) and 1 (C)). The amount of psychosis production after the reaction is shown in Table 2 below. Table 2

    [058] As shown in Table 2, it was confirmed that the psychosis producing capacities of Corynebacterium glutamicum ATCC13032/SPL1-ATPE-2 and ATCC13032/SPL7-ATPE-2 were improved by 321% and 258% compared to those of Corynebacterium glutamicum ATCC13032/CJ4-ATPE-2, respectively. From the above, it was confirmed that when the SPL1 and SPL7 promoters of the present disclosure were used, the amount of gene expression encoding ATPE was increased, thus confirming that ATPE activity was significantly increased. 2-2. Evaluation of the ability to produce tagatose (3) Preparation of vectors and transformed strains for the expression of UxaE that include an SPL13 promoter sequence
    [059] Vectors for Corynebacterium strains were prepared by cloning the tagatose epimerase (UxaE) gene derived from Thermotoga neapolitana with the use of CJ4-GFP, in which GFP is inserted, and SPL13-GFP prepared in Example 1. A open reading frame (ORF) of the TN(m) gene was amplified by performing PCR (30 reaction cycles of 30 seconds at 94 °C, 30 seconds at 55 °C and 1 minute at 72 °C) using the pET28a vector -TN(m) (SEQ NO: 11) as template together with the primers of SEQ ID Nos: 12 and 13. The amplified gene TN(m) and the vectors CJ4-GFP and SPL13-GFP for the Corynebacterium strains were treated with restriction enzymes EcoRV and PstI, and then ligated, and thus vectors pCJ4-TN(m) and pSPL13-TN(m) for Corynebacterium strains were finally prepared.
    [060] The vectors pCJ4-TN(m) and pSPL13-TN(m) thus prepared were introduced into the ATCC13032 strain by electroporation and therefore strains ATCC13032/CJ4-TN (m) and SPL13-TN (m) were prepared. (4) Assessment of the ability to produce tagatose by transformed strains
    [061] The strains prepared by the above procedure were cultured and pretreated in the same media and the culture conditions described in Example 1 and the strains for the activation of UxaE were purchased. Activity evaluation was performed by changing only the amount of substrate, reaction temperature and time in the same way as in Example 2-1 (when reacting at 60 °C for 2 hours after adding a fructose solution (100 g/L)). Then, the supernatant was recovered by centrifugation and the amount of tagatose production was measured by HPLC analysis (figures 2(A) and 2(B)). The amount of tagatose production after the reaction was indicated in Table 3 below. Table 3

    [062] As shown in Table 3, the tagatose production capacity of Corynebacterium glutamicum ATCC13032/SPL13-TN(m) was improved by 143% compared to that of Corynebacterium glutamicum ATCC13032/CJ4-TN(m). From the above, it was confirmed that when the SPL13 promoter of the present disclosure was used, the amount of expression of the gene encoding UxaE was increased, thus confirming that the activity of UxaE was significantly increased. 2-3. Evaluation of Valine Production Capacity (5) Preparation of pECCG117-SPL7-ilvE vector and transformed strains that include an SPL7 promoter sequence
    [063] For the confirmation of L-valine production capacity from an example of L-amino acids, the vectors pECCG117-CJ7-ilvE and pECCG117-SPL7-ilvE were prepared as follows, in order to increase the activity of ilvE enzyme (NCgl2123), which encodes a branched-chain amino acid aminotransferase, which is an important gene for valine biosynthesis. Specifically, as a result of running PCR (30 reaction cycles of 30 seconds at 94 °C, 30 seconds at 55 °C, and 1 minute at 72 °C) using chromosome ATCC14067 as a template, together with the primers of SEQ ID Nos: 14 and 15, a PCR fragment with a size of about 1104 bp, which has an EcoRV restriction site at the 5' end and a PstI restriction site at the 3' end of the NCg12123 gene, was amplified. The PCR fragment thus obtained was purified and mixed with pECCG117-CJ7-GFP (Korean Patent No. 10-0620092) and pECCG117-SPL7-GFP, which was treated with the restriction enzymes EcoRV and PstI, respectively, and the vectors were prepared using the Infusion Cloning Kit. The vectors thus prepared were named as pECCG117-CJ7-ilvE and pECCG117-SPL7-ilvE, respectively. SEQ NO: 14 5' GAGATCAAAACAGATATCATGACGTCATTAGAGTTC 3' SEQ NO: 15 5' ATCCCCCGGGCTGCAGTTAGCCAACCAGTGGGTA 3'
    [064] The recombinant vectors thus prepared pECCG117-CJ7-ilvE and pECCG117-SPL7-ilvE, and the vector pECCG117 was transformed into a valine-producing strain, Corynebacterium glutamicum KCCM11201P (Korean Patent No. 101117022), by an electric pulse method , and the transformed strains were obtained on an LB agar plate containing kanamycin (25 mg/L). The strains thus obtained were named as KCCM11201P/pECCG117, KCCM11201P/CJ7-ilvE, and KCCM11201P/SPL7-ilvE, respectively. (6) Evaluation of the ability to produce valine by transformed strains
    [065] The ability to produce L-valine by the 3 different types of transformed strains was analyzed by culture as described below.
    [066] Each of the strains in a one-cycle platinum amount was inoculated into a 250 mL baffle corner flask containing 25 mL of a production medium and grown in a shaking incubator (200 rpm) at 30° C for 72 hours. Upon completion of cultivation, the concentration of L-valine in each culture was analyzed by HPLC (SHIMADZU LC-20AD). Production medium (pH 7.2)
    [067] Glucose (50 g), (NH4)2SO4 (20 g), corn solids (20 g), KH2PO4 (1 g), MgSO47H2O (0.5 g), Biotin (200 μg) (based on 1 L of distilled water).
    [068] The above cultivation and analysis were performed repeatedly, and the analyzed concentrations of L-valine are shown in Table 4 below. Table 4

    [069] As shown in Table 4, it was confirmed that the valine production capacity of the KCCM11201P/SPL7-ilvE strain, where the promoter of the present disclosure is introduced, was improved by 21.8% compared to that of Corynebacterium glutamicum KCCM11201P/ CJ7-ilvE, where a known promoter is introduced, and additionally was improved by 39.2% compared to the control group, KCCM11201P/pECCG117. From the above results, it was confirmed that the SPL7 promoter increased the expression of the ilvE gene, thus significantly increasing the activity of the enzyme encoded by the corresponding gene. 2-4. Evaluation of Lysine Production Capacity (7) Preparation of pDZTn-SPL13-gapN1 vector and transformed strains that include an SPL13 promoter sequence
    [070] For confirmation of L-lysine production capacity as a representative example of L-amino acids, vectors were prepared as follows in order to increase the activity of NADP-dependent glyceraldehyde-3-phosphate dehydrogenase enzyme ( GapN), which is derived from known Streptococcus mutants.
    [071] For insertion into a transposable NCgl2392 gene in a microorganism of the Corynebacterium genus, PCR (30 reaction cycles of 30 seconds at 94 °C, 30 seconds at 55 °C, and 1 minute at 72 °C) was performed using the wild-type Corynebacterium glutamicum ATCC13032 chromosome as a template, together with the following primers of SEQ No.: 16, SEQ No.: 17, SEQ No.: 18, and SEQ No.: 19, based on NIH gene bank from NIH (USA), and as a result, the fragments that include the 5' end and the 3' end of the NCgl2392 gene were amplified. As a result of performing PCR (30 reaction cycles of 30 seconds at 94 °C, 30 seconds at 55 °C and 2 min at 72 °C) using the vector pECCG122-Pcj7-gapN1 (Korean Patent No. 10 -1182033) together with the following primers of SEQ NO:20 and SEQ NO:21, Pcj7-gapN1 was amplified. As a result of performing PCR (30 reaction cycles of 30 seconds at 94 °C, 30 seconds at 55 °C, and 1 minute at 72 °C) using the pECCG122-pcj7-gapN1 vector and the SPL13- vector GFP prepared in Example 1, together with the following primers from the genes SEQ N°: 22, SEQ N°: 23, SEQ N°: 24 and SEQ N°: 21, the SPL13 and gapN genes were amplified, respectively, and these genes were cloned into the pDZ vector (Korean Patent 0924065), which is not replicable in Corynebacterium glutamicum, together with the NCgl2392 gene fragments prepared above, and thus the pDZTn-pcj7-gapN1 and pDZTn-SPL13-gapN1 vectors were prepared. SEQ ID NO: 16 5' ATCCTCTAGAGTCGACCAAATGCTCCAACCGTCCGT 3' SEQ ID NO: 17 5' CTCGAGGAACTCATTCCTTCTGCTCG 3' SEQ ID NO: 18 5' TCTAGAACTAGTGGGCCCGACATCTAATAACCGGGCAG 3' SEQ ID NO: 19 5' ATGCCCATGACGTCGACTGACTGACCAGTCGATCAA 3'CGACTGATCGATCGATCGA SEQ ID NO: 21 5' GCCCACTAGTTCTAGATTATTTGATATCAAATACGA 3' SEQ ID NO: 22 5' GAATGAGTTCCTCGAGGGCGCTTCATGTCAACAATC 3' SEQ ID NO: 23 5' ATTGTTTTGTCATATGTGTTTTGATCTCCTCCAATA 3' SEQ ID NO: 24 5' CAATATG
    [072] Each of the vectors mentioned above (pDZTn-pcj7-gapN1 and pDZTn-SPL13-gapN1) was transformed using the KCCM11016P strain with improved lysine production capacity (the microorganism was disclosed as KFCC1088 1, redeposited to an international depositary authority under the Budapest treaty, and assigned an accession number of KCCM11016P; Korean Patent No. 10-0159812) as a strain of origin, by the electrical pulse method (“Appl. Microbiol. Biotechnol.” (1999) 52: 541-545) and transformed strains were obtained on a selective medium containing 25 mg/L of kanamycin. In order to select colonies in which the gapN1 gene was inserted into the genome by secondary recombination process (crossover), the colonies where the Pcj7-gapN1 and SPL13-gapN1 genes are inserted, respectively, were obtained using pairs of primers. SEQ ID Nos: 20 and 21 and SEQ ID Nos: 21 and 22. The colonies thus obtained were named as KCCM11016P/CJ7-gapN1 and KCCM11016P/SPL13-gapN1, respectively. (8) Assessment of the ability to produce lysine by transformed strains
    [073] The ability to produce L-lysine by the 3 different types of transformed strains was analyzed by culture as described below.
    [074] Each of the strains was inoculated into a 250 mL deflector corner flask containing 25 mL of a seed medium and grown in a shaking incubator (200 rpm) at 30 °C for 20 hours. Then, 1 mL of the seed culture was inoculated into a 250 mL deflector corner flask containing 24 mL of a production medium and cultivated in a shaking incubator (200 rpm) at 30 °C for 72 hours . The concentration of L-lysine in each culture was analyzed by HPLC (SHIMADZU, LC-20AD). Seed medium (pH 7.0)
    [075] Glucose (20 g), peptone (10 g), yeast extract (5 g), urea (1.5 g), KH2PO4 (4 g), K2HPO4 (8 g), MgSO4-7H2O (0.5 g), biotin (100 μg), thiamine HCl (1000 μg), calcium-pantothenic acid (2000 μg), nicotinamide (2000 μg) (based on 1 L distilled water) Production medium (pH 7.0)
    [076] Glucose (100 g), (NH 4) 2 SO 4 (40 g), Soy Protein (2.5 g), Corn Steep Solids (5 g), Urea (3 g), KH2PO4 (1 g ), MgSO4-7H2O (0.5 g), Biotin (100 μg), thiamine HCl salt (1000 μg), calcium-pantothenic acid (2000 μg), nicotinamide (3000 μg) and CaCO3 (30 g) (with base on 1 L of distilled water).
    [077] The above cultivation and analysis were performed repeatedly, and the analyzed L-lysine concentrations are shown in Table 5 below. Table 5


    [078] As shown in Table 5, it was confirmed that the ability to produce lysine by the KCCM11016P/SPL13-gapN1 strain, where the present disclosure promoter is introduced, was improved by 7.2% compared to that of Corynebacterium glutamicum KCCM11016P/CJ7-gapN1. where a known promoter is introduced, and additionally it was improved by 22.7% compared to the control group, KCCM11016P. From the above results, it was confirmed that the SPL13 promoter increased gapN1 gene expression, thus significantly increasing the activity of the enzyme encoded by the corresponding gene.
    [079] Summarizing the above results, the SPL1, SPL7 and SPL13 promoters of the present disclosure can significantly increase the expression of a target gene in a recombinant microorganism, compared to known conventional promoters. Consequently, the promoters of the present disclosure can not only provide an effective expression system, but can also be used effectively in various industrial fields for high-yield production of target products such as saccharides, functional materials and amino acids.
    权利要求:
    Claims (7)
    [0001]
    1. Nucleic acid molecule that has a promoter activity, CHARACTERIZED by the fact that it consists of any nucleotide sequence selected from the group consisting of SEQ Nos: 1 to 3.
    [0002]
    2. Gene expression cassette, CHARACTERIZED by the fact that it comprises the nucleic acid molecule, as defined in claim 1, and a target gene.
    [0003]
    3. Recombinant vector, CHARACTERIZED by the fact that it comprises: (i) the nucleic acid molecule as defined in claim 1; or (ii) a gene expression cassette comprising the nucleic acid molecule and a target gene.
    [0004]
    4. Recombinant microorganism of the Corynebacterium genus, CHARACTERIZED by the fact that it comprises the nucleic acid molecule, as defined in claim 1, or the vector as defined in claim 3.
    [0005]
    5. Recombinant microorganism, according to claim 4, CHARACTERIZED by the fact that the microorganism of the Corynebacterium genus is Corynebacterium glutamicum or Corynebacterium ammoniagenesis.
    [0006]
    6. Method of producing a target product, CHARACTERIZED by the fact that it comprises: (a) cultivating the recombinant microorganism, as defined in claim 4, in a medium; and (b) recovering a target product from the microorganism or from the medium in which the microorganism was cultured.
    [0007]
    7. Method according to claim 6, CHARACTERIZED by the fact that the target product is psychosis, tagatose or an amino acid.
    类似技术:
    公开号 | 公开日 | 专利标题
    BR112019004161B1|2021-07-27|NUCLEIC ACID MOLECULE THAT HAVE A PROMOTER ACTIVITY, GENE EXPRESSION CASSETTE, RECOMBINANT VECTOR, RECOMBINANT MICROORGANISM OF THE GENUS CORYNEBACTERIUM AND METHOD OF PRODUCING A TARGET PRODUCT
    BR112019014131A2|2020-03-10|ADENYL SUCCINATE SYNTHETASE VARIANT, POLYNUCLEOTIDE, VECTOR, MICROORGANISM OF THE CORYNEBACTERIUM GENDER AND METHOD FOR PREPARING PURINE NUCLEOTIDS
    JP6469874B2|2019-02-13|New promoters and their uses
    JP6297134B2|2018-03-20|Microorganism having putrescine productivity and putrescine production method using the same
    CN108884449B|2022-01-25|Novel isopropylmalate synthase variants and method for producing L-leucine using same
    RU2721852C1|2020-05-25|Microorganisms for producing ornithine and method of producing ornithine using said microorganisms
    JP5400065B2|2014-01-29|Improved promoter and method for producing L-lysine using the same
    BR122020018773B1|2021-06-22|MODIFIED POLYPEPTIDE HAVING CITRATE SYNTASE ACTIVITY, CORYNEBACTERIUM GENDER MICROORGANISM AND METHOD TO PRODUCE AN L-AMINO ACID
    RU2733426C1|2020-10-01|Modified homoserine dehydrogenase and method for producing homoserine or l-amino acid of homoserine origin using such homoserine dehydrogenase
    JP2022513813A|2022-02-09|A mutant strain with improved L-glutamic acid production ability, and a method for producing L-glutamic acid using the mutant strain.
    JP6476212B2|2019-02-27|Microbe of Corynebacterium that produces L-arginine and method for producing L-arginine using the same
    BR112020002790A2|2021-07-20|camp receptor protein variant, polynucleotide, vector, escherichia microorganism, method for producing an l-amino acid, and, use of a receptor protein variant
    ES2739002T3|2020-01-28|Microorganisms to produce putrescine or ornithine and process to produce putrescine or ornithine using them
    KR102011394B1|2019-10-22|Microorganism producing putrescine and method of producing putrescine using the microorganism
    ES2860698T3|2021-10-05|New developer and use of it
    KR102285951B1|2021-08-04|Novel modified polypeptide with attenuated activity of citrate synthase and a method for producing L-amino acid using the same
    JP6998466B2|2022-02-04|Mutant polypeptide with weakened citrate synthase activity and L-amino acid production method using it
    KR102277407B1|2021-07-14|Novel glutamate synthase subunit alpha variant and a method for producing L-glutamic acid using the same
    ES2745561T3|2020-03-02|Variant of the gluconate repressor, L-lysine producing microorganism comprising this variant and a procedure to produce L-lysine by its use
    TWI510621B|2015-12-01|Recombinant microorganisms with an improved productivity of putrescine and method for producing putrescine using the same
    BR112019021322A2|2020-09-15|glucoamylase variant, methods for increasing the crude starch hydrolysis activity of a glucoamylase and for producing a glucoamylase variant, composition, use of a glucoamylase variant, processes for producing a fermentation product and for producing a syrup product, polynucleotide encoding the glucoamylase variant, nucleic acid construct, expression vector, and host cell
    KR20220003411A|2022-01-10|Microorganism having inhanced activity of 3-methyl-2-oxobutanoate hydroxymethyltransferase and uses thereof
    US20200377558A1|2020-12-03|Novel polypeptide and method of producing imp using the same
    同族专利:
    公开号 | 公开日
    US10584338B2|2020-03-10|
    CN108026539A|2018-05-11|
    EP3508580B1|2022-01-12|
    CN108026539B|2019-06-07|
    JP6679803B2|2020-04-15|
    CN108559746B|2021-09-03|
    RU2733425C1|2020-10-01|
    CN108559746A|2018-09-21|
    BR112019004161A2|2019-09-03|
    EP3508580A4|2020-03-18|
    CN108559747B|2021-08-31|
    WO2018043856A1|2018-03-08|
    EP3508580A1|2019-07-10|
    CN110283823A|2019-09-27|
    CN108559747A|2018-09-21|
    US20190185857A1|2019-06-20|
    JP2019528075A|2019-10-10|
    DK3508580T3|2022-03-07|
    KR101783170B1|2017-09-29|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    KR920007401B1|1990-06-21|1992-08-31|제일제당 주식회사|Novel shuttle vector|
    KR0159812B1|1995-12-20|1998-11-16|손경식|Corynebacterium glutamicum ch77 and method for producing l-lysine|
    DE19548222A1|1995-12-22|1997-06-26|Forschungszentrum Juelich Gmbh|Process for the microbial production of amino acids through increased activity of export carriers|
    KR100620092B1|2004-12-16|2006-09-08|씨제이 주식회사|Novel promoter nucleic acid derived from corynebacterium genus bacteria expression cassette comprising the promoter and vector comprising the cassette host cell comprising the vector and method for expressing a gene using the cell|
    KR100924065B1|2006-09-15|2009-10-27|씨제이제일제당 |A corynebacteria having enhanced L-lysine productivity and a method of producing L-lysine using the same|
    KR100987281B1|2008-01-31|2010-10-12|씨제이제일제당 |Enhanced promoter and method for producing L-lysine using the same|
    CN101698844B|2009-06-29|2012-01-04|中国科学院微生物研究所|Promoter from corynebacterium glutamicum and application thereof|
    KR101182033B1|2009-07-08|2012-09-11|씨제이제일제당 |The Method of L-lysine production in corynebacteirum sp. by amplifying glyceraldehyde-3-phophate dehydrogenase gene derived from other|
    KR101226384B1|2010-03-05|2013-01-25|씨제이제일제당 |Enhanced promoter and method for producing L-lysine using the same|
    KR101117022B1|2011-08-16|2012-03-16|씨제이제일제당 |A microorganism having enhanced l-valine production and process for preparing l-valine using the same|
    KR101335853B1|2011-12-01|2013-12-02|씨제이제일제당 |A microorganism having L-amino acids and riboflavin productivity and a method of producing L-amino acids and riboflavin using the same|
    KR20140066553A|2012-11-23|2014-06-02|삼성전자주식회사|Novel promoter of corynebacterium genus|
    KR101481142B1|2013-03-04|2015-01-15|한국과학기술원|Synthetic Promoter for Expressing Corynebacteria|
    KR20140140215A|2013-05-28|2014-12-09|경상대학교산학협력단|Corynebacterium including polynucleotide coding psicose 3-epimerase and producing method for Psicose using the same|
    BR112015029933A2|2013-06-05|2019-02-05|Cj Cheiljedang Corp|tagatose production method|
    KR101504900B1|2013-06-27|2015-03-23|백광산업 주식회사|A Mutation of Transketolase gene Promoter and Use thereof|
    CN107109443B|2014-11-06|2021-11-02|庆尚大学校产学协力团|Preparation method of psicose|
    CN104611249B|2014-11-17|2019-06-11|中国科学院天津工业生物技术研究所|A method of D-Psicose is synthesized using the full cell of aldolase|
    KR101632642B1|2015-01-29|2016-06-22|씨제이제일제당 주식회사|Novel promoter and uses thereof|KR102035844B1|2018-02-23|2019-10-23|씨제이제일제당 주식회사|Recombinant coryneform microorganism to produce L-tryptophan and method for producing L-tryptophan using the same|
    KR101968317B1|2018-02-23|2019-04-11|씨제이제일제당 주식회사|Novel L-tryptophan export protein and the method of producing L-tryptophan usingthe same|
    KR102003911B1|2018-02-23|2019-07-25|씨제이제일제당 주식회사|A microorganism for producing a Mycosporine-like amino acid and a method for preparing a Mycosporine-like amino acid using the same|
    KR102016050B1|2018-03-20|2019-08-29|씨제이제일제당 주식회사|Novel promoter and uses thereof|
    KR101947959B1|2018-05-28|2019-02-13|씨제이제일제당 |A modified homoserine dehydrogenase and a method for producing homoserine or L- amino acid derived from homoserine using the same|
    CN109097361B|2018-08-28|2020-02-14|江南大学|Promoter, vector thereof and application thereof|
    KR102112240B1|2018-09-28|2020-05-18|씨제이제일제당 주식회사|A microorganism producing L-amino acids with enhanced alpha-glucosidase activity and a method for producing L-amino acids using the same|
    KR101996769B1|2018-12-21|2019-10-01|씨제이제일제당 |A homoserine dehydrogenase variant and a method for producing homoserine or L-amino acid derived from homoserine using the same|
    KR102204917B1|2019-04-22|2021-01-20|씨제이제일제당 주식회사|Microorganisms with enhanced ability to produce L-histidine and methods for producing L-histidine using the same|
    KR102221040B1|2019-05-09|2021-03-03|씨제이제일제당 주식회사|Microorganism producing L-amino acid and method of producing Method of L-amino acid using thereof|
    KR20210002260A|2019-06-28|2021-01-07|씨제이제일제당 |A method of producing sulfur-containing amino acids and derivatives thereof|
    KR20210002259A|2019-06-28|2021-01-07|씨제이제일제당 |A method of producing sulfur-containing amino acids and derivatives thereof|
    KR102183209B1|2019-09-09|2020-11-26|씨제이제일제당 주식회사|Variants of L-threonine efflux protein and methods for producing L-threonine using them|
    KR102207867B1|2020-01-21|2021-01-26|씨제이제일제당 주식회사|Method for producing L-amino acids using microorganisms containing NADP dependent glyceraldehyde-3-phosphate dehydrogenase|
    KR102198072B1|2020-03-04|2021-01-04|씨제이제일제당 주식회사|A modified polypeptide of glutamine synthetase and a method for L-glutamine using the same|
    法律状态:
    2021-06-01| B09A| Decision: intention to grant [chapter 9.1 patent gazette]|
    2021-07-27| B16A| Patent or certificate of addition of invention granted [chapter 16.1 patent gazette]|Free format text: PRAZO DE VALIDADE: 20 (VINTE) ANOS CONTADOS A PARTIR DE 20/03/2017, OBSERVADAS AS CONDICOES LEGAIS. |
    优先权:
    申请号 | 申请日 | 专利标题
    KR10-2016-0111810|2016-08-31|
    KR20160111810|2016-08-31|
    PCT/KR2017/002964|WO2018043856A1|2016-08-31|2017-03-20|Novel promoter and use thereof|
    [返回顶部]